Skip to main content

Advertisement

Table S2 Oligonucleotide primers used in site-directed mutagenesis reactions

From: Characterisation of a functional intronic polymorphism in the human growth hormone (GHI) gene

Primer Oligonucleotide sequence (5' > 3')a
GHFLAG5 TGGAGGGCAGCTGTGGCTTCGACTACAAAGACGATGACGACAAGTAGCTGCCCGGGTGGCATCC
GHMYC5 TGGAGGGCAGCTGTGGCTTCGAACAAAAACTCATCTCAGAAGAGGATCTGTAGCTGCCCGGGTGGCATCC
-278T CCACCATGGCCTGCTGCCAGAGGGCACCC
-57G AGAAACAGGTGGGGGCAACAGTGGGAGAG
1169A5 CCTCTTTTTAGCAGACAGGCCCTGACCCA
2103T5 GGACATTTGAGTTGTTTGCTTGGCACTGT
2498G5 TCCAGCCTCAAAGAGCTTACAGTCTGGTA
  1. aOnly the sequence of the sense strand oligonucleotide is shown. Bases inserted or changed are shown in bold